ID: 1087314690

View in Genome Browser
Species Human (GRCh38)
Location 11:96590223-96590245
Sequence GCCAAGGAATGCCGCAGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087314686_1087314690 -4 Left 1087314686 11:96590204-96590226 CCAGAAATATGGCCACTGGGCCA No data
Right 1087314690 11:96590223-96590245 GCCAAGGAATGCCGCAGCCCGGG No data
1087314681_1087314690 17 Left 1087314681 11:96590183-96590205 CCCAGGAGCTTGCTACACGTGCC 0: 33
1: 356
2: 166
3: 108
4: 133
Right 1087314690 11:96590223-96590245 GCCAAGGAATGCCGCAGCCCGGG No data
1087314680_1087314690 18 Left 1087314680 11:96590182-96590204 CCCCAGGAGCTTGCTACACGTGC 0: 74
1: 446
2: 174
3: 133
4: 131
Right 1087314690 11:96590223-96590245 GCCAAGGAATGCCGCAGCCCGGG No data
1087314679_1087314690 19 Left 1087314679 11:96590181-96590203 CCCCCAGGAGCTTGCTACACGTG 0: 32
1: 397
2: 207
3: 126
4: 193
Right 1087314690 11:96590223-96590245 GCCAAGGAATGCCGCAGCCCGGG No data
1087314678_1087314690 22 Left 1087314678 11:96590178-96590200 CCTCCCCCAGGAGCTTGCTACAC 0: 54
1: 387
2: 229
3: 122
4: 210
Right 1087314690 11:96590223-96590245 GCCAAGGAATGCCGCAGCCCGGG No data
1087314682_1087314690 16 Left 1087314682 11:96590184-96590206 CCAGGAGCTTGCTACACGTGCCA No data
Right 1087314690 11:96590223-96590245 GCCAAGGAATGCCGCAGCCCGGG No data
1087314677_1087314690 25 Left 1087314677 11:96590175-96590197 CCTCCTCCCCCAGGAGCTTGCTA 0: 323
1: 289
2: 106
3: 91
4: 375
Right 1087314690 11:96590223-96590245 GCCAAGGAATGCCGCAGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087314690 Original CRISPR GCCAAGGAATGCCGCAGCCC GGG Intergenic
No off target data available for this crispr