ID: 1087315251

View in Genome Browser
Species Human (GRCh38)
Location 11:96594868-96594890
Sequence AGAATAATCCTCCACTTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087315251_1087315252 2 Left 1087315251 11:96594868-96594890 CCACTAAAGTGGAGGATTATTCT No data
Right 1087315252 11:96594893-96594915 TCCACTGAGAAAATACATTATGG No data
1087315251_1087315254 25 Left 1087315251 11:96594868-96594890 CCACTAAAGTGGAGGATTATTCT No data
Right 1087315254 11:96594916-96594938 CTCTTTATTGTTGTTATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087315251 Original CRISPR AGAATAATCCTCCACTTTAG TGG (reversed) Intergenic
No off target data available for this crispr