ID: 1087315252

View in Genome Browser
Species Human (GRCh38)
Location 11:96594893-96594915
Sequence TCCACTGAGAAAATACATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087315251_1087315252 2 Left 1087315251 11:96594868-96594890 CCACTAAAGTGGAGGATTATTCT No data
Right 1087315252 11:96594893-96594915 TCCACTGAGAAAATACATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087315252 Original CRISPR TCCACTGAGAAAATACATTA TGG Intergenic
No off target data available for this crispr