ID: 1087317582

View in Genome Browser
Species Human (GRCh38)
Location 11:96622121-96622143
Sequence AAGCATGTCTATAACCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087317582_1087317586 7 Left 1087317582 11:96622121-96622143 CCTTCCTGGTTATAGACATGCTT No data
Right 1087317586 11:96622151-96622173 GGCTCATTAATTATGTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087317582 Original CRISPR AAGCATGTCTATAACCAGGA AGG (reversed) Intergenic
No off target data available for this crispr