ID: 1087319205

View in Genome Browser
Species Human (GRCh38)
Location 11:96638448-96638470
Sequence CTATAGGTAGGATAGGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087319205_1087319216 28 Left 1087319205 11:96638448-96638470 CCCATATCCTATCCTACCTATAG No data
Right 1087319216 11:96638499-96638521 TCTAATCTCCCCTACCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087319205 Original CRISPR CTATAGGTAGGATAGGATAT GGG (reversed) Intergenic
No off target data available for this crispr