ID: 1087319954

View in Genome Browser
Species Human (GRCh38)
Location 11:96645949-96645971
Sequence AAAAGGAGATTTAACCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087319954_1087319958 24 Left 1087319954 11:96645949-96645971 CCTTCAGGGTTAAATCTCCTTTT No data
Right 1087319958 11:96645996-96646018 TCTTTCACTTTCTTCTCTACAGG No data
1087319954_1087319956 0 Left 1087319954 11:96645949-96645971 CCTTCAGGGTTAAATCTCCTTTT No data
Right 1087319956 11:96645972-96645994 GCTTCTCAACTCCTAGAATCAGG No data
1087319954_1087319959 29 Left 1087319954 11:96645949-96645971 CCTTCAGGGTTAAATCTCCTTTT No data
Right 1087319959 11:96646001-96646023 CACTTTCTTCTCTACAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087319954 Original CRISPR AAAAGGAGATTTAACCCTGA AGG (reversed) Intergenic
No off target data available for this crispr