ID: 1087328188

View in Genome Browser
Species Human (GRCh38)
Location 11:96748484-96748506
Sequence TCGCCCCATAGTTGCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087328188_1087328191 27 Left 1087328188 11:96748484-96748506 CCTGGGCTGCAACTATGGGGCGA No data
Right 1087328191 11:96748534-96748556 TCATTTGTCTTTGGCATTTAAGG No data
1087328188_1087328190 18 Left 1087328188 11:96748484-96748506 CCTGGGCTGCAACTATGGGGCGA No data
Right 1087328190 11:96748525-96748547 TTTTAGCATTCATTTGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087328188 Original CRISPR TCGCCCCATAGTTGCAGCCC AGG (reversed) Intergenic
No off target data available for this crispr