ID: 1087336145

View in Genome Browser
Species Human (GRCh38)
Location 11:96847516-96847538
Sequence TGTTTGTCAGATATCTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087336145_1087336153 18 Left 1087336145 11:96847516-96847538 CCTTTCAAGATATCTGACAAACA No data
Right 1087336153 11:96847557-96847579 GCCAAGGGGACACTGGGCTATGG No data
1087336145_1087336149 3 Left 1087336145 11:96847516-96847538 CCTTTCAAGATATCTGACAAACA No data
Right 1087336149 11:96847542-96847564 TGTGGTATGGCTGCAGCCAAGGG No data
1087336145_1087336147 -10 Left 1087336145 11:96847516-96847538 CCTTTCAAGATATCTGACAAACA No data
Right 1087336147 11:96847529-96847551 CTGACAAACAAGTTGTGGTATGG No data
1087336145_1087336151 11 Left 1087336145 11:96847516-96847538 CCTTTCAAGATATCTGACAAACA No data
Right 1087336151 11:96847550-96847572 GGCTGCAGCCAAGGGGACACTGG No data
1087336145_1087336148 2 Left 1087336145 11:96847516-96847538 CCTTTCAAGATATCTGACAAACA No data
Right 1087336148 11:96847541-96847563 TTGTGGTATGGCTGCAGCCAAGG No data
1087336145_1087336155 28 Left 1087336145 11:96847516-96847538 CCTTTCAAGATATCTGACAAACA No data
Right 1087336155 11:96847567-96847589 CACTGGGCTATGGATAGCTCTGG No data
1087336145_1087336150 4 Left 1087336145 11:96847516-96847538 CCTTTCAAGATATCTGACAAACA No data
Right 1087336150 11:96847543-96847565 GTGGTATGGCTGCAGCCAAGGGG No data
1087336145_1087336152 12 Left 1087336145 11:96847516-96847538 CCTTTCAAGATATCTGACAAACA No data
Right 1087336152 11:96847551-96847573 GCTGCAGCCAAGGGGACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087336145 Original CRISPR TGTTTGTCAGATATCTTGAA AGG (reversed) Intergenic
No off target data available for this crispr