ID: 1087343483

View in Genome Browser
Species Human (GRCh38)
Location 11:96938453-96938475
Sequence CACCCCATGCTCTCACTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087343483_1087343489 18 Left 1087343483 11:96938453-96938475 CCTATAAGTGAGAGCATGGGGTG No data
Right 1087343489 11:96938494-96938516 TGTTAGTTTGCTGGGGATAATGG No data
1087343483_1087343487 11 Left 1087343483 11:96938453-96938475 CCTATAAGTGAGAGCATGGGGTG No data
Right 1087343487 11:96938487-96938509 ATTCCTGTGTTAGTTTGCTGGGG 0: 73
1: 1722
2: 2750
3: 3453
4: 4170
1087343483_1087343485 9 Left 1087343483 11:96938453-96938475 CCTATAAGTGAGAGCATGGGGTG No data
Right 1087343485 11:96938485-96938507 CTATTCCTGTGTTAGTTTGCTGG No data
1087343483_1087343486 10 Left 1087343483 11:96938453-96938475 CCTATAAGTGAGAGCATGGGGTG No data
Right 1087343486 11:96938486-96938508 TATTCCTGTGTTAGTTTGCTGGG 0: 4
1: 98
2: 141
3: 266
4: 705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087343483 Original CRISPR CACCCCATGCTCTCACTTAT AGG (reversed) Intergenic
No off target data available for this crispr