ID: 1087347496 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:96990342-96990364 |
Sequence | GTGAAAAAACAGATGGATCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1087347490_1087347496 | 13 | Left | 1087347490 | 11:96990306-96990328 | CCCACAATATCTTCATGCAGCTT | No data | ||
Right | 1087347496 | 11:96990342-96990364 | GTGAAAAAACAGATGGATCAGGG | No data | ||||
1087347491_1087347496 | 12 | Left | 1087347491 | 11:96990307-96990329 | CCACAATATCTTCATGCAGCTTG | No data | ||
Right | 1087347496 | 11:96990342-96990364 | GTGAAAAAACAGATGGATCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1087347496 | Original CRISPR | GTGAAAAAACAGATGGATCA GGG | Intergenic | ||
No off target data available for this crispr |