ID: 1087347496

View in Genome Browser
Species Human (GRCh38)
Location 11:96990342-96990364
Sequence GTGAAAAAACAGATGGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087347490_1087347496 13 Left 1087347490 11:96990306-96990328 CCCACAATATCTTCATGCAGCTT No data
Right 1087347496 11:96990342-96990364 GTGAAAAAACAGATGGATCAGGG No data
1087347491_1087347496 12 Left 1087347491 11:96990307-96990329 CCACAATATCTTCATGCAGCTTG No data
Right 1087347496 11:96990342-96990364 GTGAAAAAACAGATGGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087347496 Original CRISPR GTGAAAAAACAGATGGATCA GGG Intergenic
No off target data available for this crispr