ID: 1087351254

View in Genome Browser
Species Human (GRCh38)
Location 11:97035644-97035666
Sequence GAGCTTACCATGAAGAACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087351252_1087351254 -6 Left 1087351252 11:97035627-97035649 CCTCAACTGGGATTAAAGAGCTT No data
Right 1087351254 11:97035644-97035666 GAGCTTACCATGAAGAACAAGGG No data
1087351251_1087351254 5 Left 1087351251 11:97035616-97035638 CCATGGCTTAGCCTCAACTGGGA No data
Right 1087351254 11:97035644-97035666 GAGCTTACCATGAAGAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087351254 Original CRISPR GAGCTTACCATGAAGAACAA GGG Intergenic
No off target data available for this crispr