ID: 1087353144

View in Genome Browser
Species Human (GRCh38)
Location 11:97059669-97059691
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087353141_1087353144 26 Left 1087353141 11:97059620-97059642 CCATATTGACTGCACAGATACAA No data
Right 1087353144 11:97059669-97059691 GCAGCCTGCTTGGCTGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087353144 Original CRISPR GCAGCCTGCTTGGCTGAAAT TGG Intergenic