ID: 1087353144 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:97059669-97059691 |
Sequence | GCAGCCTGCTTGGCTGAAAT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1087353141_1087353144 | 26 | Left | 1087353141 | 11:97059620-97059642 | CCATATTGACTGCACAGATACAA | No data | ||
Right | 1087353144 | 11:97059669-97059691 | GCAGCCTGCTTGGCTGAAATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1087353144 | Original CRISPR | GCAGCCTGCTTGGCTGAAAT TGG | Intergenic | ||