ID: 1087353526

View in Genome Browser
Species Human (GRCh38)
Location 11:97063813-97063835
Sequence CTCTCTTCTTAGTTTAGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087353526_1087353529 11 Left 1087353526 11:97063813-97063835 CCCTAGCTAAACTAAGAAGAGAG No data
Right 1087353529 11:97063847-97063869 AATACAATCAGAAATGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087353526 Original CRISPR CTCTCTTCTTAGTTTAGCTA GGG (reversed) Intergenic
No off target data available for this crispr