ID: 1087354828

View in Genome Browser
Species Human (GRCh38)
Location 11:97079333-97079355
Sequence CTCATTATGAAACTTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087354828_1087354829 0 Left 1087354828 11:97079333-97079355 CCAGGCAGAAGTTTCATAATGAG No data
Right 1087354829 11:97079356-97079378 TTTGCAAGATACACTCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087354828 Original CRISPR CTCATTATGAAACTTCTGCC TGG (reversed) Intergenic
No off target data available for this crispr