ID: 1087354829

View in Genome Browser
Species Human (GRCh38)
Location 11:97079356-97079378
Sequence TTTGCAAGATACACTCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087354826_1087354829 19 Left 1087354826 11:97079314-97079336 CCATTAACTTCTAAGACTGCCAG No data
Right 1087354829 11:97079356-97079378 TTTGCAAGATACACTCAAAATGG No data
1087354828_1087354829 0 Left 1087354828 11:97079333-97079355 CCAGGCAGAAGTTTCATAATGAG No data
Right 1087354829 11:97079356-97079378 TTTGCAAGATACACTCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087354829 Original CRISPR TTTGCAAGATACACTCAAAA TGG Intergenic
No off target data available for this crispr