ID: 1087359122

View in Genome Browser
Species Human (GRCh38)
Location 11:97135913-97135935
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087359122_1087359124 8 Left 1087359122 11:97135913-97135935 CCTGCTTGAATCTTTTTAGTTAC No data
Right 1087359124 11:97135944-97135966 CTTTGGTAAATTTATCTAATAGG No data
1087359122_1087359123 -9 Left 1087359122 11:97135913-97135935 CCTGCTTGAATCTTTTTAGTTAC No data
Right 1087359123 11:97135927-97135949 TTTAGTTACTTCAATCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087359122 Original CRISPR GTAACTAAAAAGATTCAAGC AGG (reversed) Intergenic
No off target data available for this crispr