ID: 1087360873

View in Genome Browser
Species Human (GRCh38)
Location 11:97157957-97157979
Sequence ATCTGATTATAGCAGAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087360873_1087360874 0 Left 1087360873 11:97157957-97157979 CCTTAATTCTGCTATAATCAGAT No data
Right 1087360874 11:97157980-97158002 TATATACTGCCTTAAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087360873 Original CRISPR ATCTGATTATAGCAGAATTA AGG (reversed) Intergenic
No off target data available for this crispr