ID: 1087361871

View in Genome Browser
Species Human (GRCh38)
Location 11:97170915-97170937
Sequence CTTGAAGCCTAAATGGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087361871_1087361875 14 Left 1087361871 11:97170915-97170937 CCTGGTACCATTTAGGCTTCAAG No data
Right 1087361875 11:97170952-97170974 AACCTGAATCTTGTGCTATATGG No data
1087361871_1087361877 30 Left 1087361871 11:97170915-97170937 CCTGGTACCATTTAGGCTTCAAG No data
Right 1087361877 11:97170968-97170990 TATATGGTTGTGTTGAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087361871 Original CRISPR CTTGAAGCCTAAATGGTACC AGG (reversed) Intergenic
No off target data available for this crispr