ID: 1087362216

View in Genome Browser
Species Human (GRCh38)
Location 11:97175449-97175471
Sequence CTCCATTAAAAGCTGGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12570
Summary {0: 2, 1: 15, 2: 322, 3: 2171, 4: 10060}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087362212_1087362216 19 Left 1087362212 11:97175407-97175429 CCTAGCATCTATAAGGAACTTAC No data
Right 1087362216 11:97175449-97175471 CTCCATTAAAAGCTGGGCAAAGG 0: 2
1: 15
2: 322
3: 2171
4: 10060

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087362216 Original CRISPR CTCCATTAAAAGCTGGGCAA AGG Intergenic
Too many off-targets to display for this crispr