ID: 1087364686

View in Genome Browser
Species Human (GRCh38)
Location 11:97203106-97203128
Sequence TTCCACCTGGCTCACAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087364682_1087364686 -1 Left 1087364682 11:97203084-97203106 CCCCACAGGCTGGGAGTTAGTTT No data
Right 1087364686 11:97203106-97203128 TTCCACCTGGCTCACAGTGTAGG No data
1087364683_1087364686 -2 Left 1087364683 11:97203085-97203107 CCCACAGGCTGGGAGTTAGTTTT No data
Right 1087364686 11:97203106-97203128 TTCCACCTGGCTCACAGTGTAGG No data
1087364679_1087364686 4 Left 1087364679 11:97203079-97203101 CCCACCCCCACAGGCTGGGAGTT No data
Right 1087364686 11:97203106-97203128 TTCCACCTGGCTCACAGTGTAGG No data
1087364673_1087364686 19 Left 1087364673 11:97203064-97203086 CCCAGAGGCAGTTGCCCCACCCC No data
Right 1087364686 11:97203106-97203128 TTCCACCTGGCTCACAGTGTAGG No data
1087364681_1087364686 0 Left 1087364681 11:97203083-97203105 CCCCCACAGGCTGGGAGTTAGTT No data
Right 1087364686 11:97203106-97203128 TTCCACCTGGCTCACAGTGTAGG No data
1087364680_1087364686 3 Left 1087364680 11:97203080-97203102 CCACCCCCACAGGCTGGGAGTTA No data
Right 1087364686 11:97203106-97203128 TTCCACCTGGCTCACAGTGTAGG No data
1087364684_1087364686 -3 Left 1087364684 11:97203086-97203108 CCACAGGCTGGGAGTTAGTTTTC No data
Right 1087364686 11:97203106-97203128 TTCCACCTGGCTCACAGTGTAGG No data
1087364674_1087364686 18 Left 1087364674 11:97203065-97203087 CCAGAGGCAGTTGCCCCACCCCC No data
Right 1087364686 11:97203106-97203128 TTCCACCTGGCTCACAGTGTAGG No data
1087364678_1087364686 5 Left 1087364678 11:97203078-97203100 CCCCACCCCCACAGGCTGGGAGT No data
Right 1087364686 11:97203106-97203128 TTCCACCTGGCTCACAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087364686 Original CRISPR TTCCACCTGGCTCACAGTGT AGG Intergenic
No off target data available for this crispr