ID: 1087364943

View in Genome Browser
Species Human (GRCh38)
Location 11:97206790-97206812
Sequence TCTTGAGGACATAAGAAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087364943_1087364948 13 Left 1087364943 11:97206790-97206812 CCCCATTTCTTATGTCCTCAAGA No data
Right 1087364948 11:97206826-97206848 CAACTGTCTTCTTAAATCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087364943 Original CRISPR TCTTGAGGACATAAGAAATG GGG (reversed) Intergenic
No off target data available for this crispr