ID: 1087367481

View in Genome Browser
Species Human (GRCh38)
Location 11:97239308-97239330
Sequence CAGTTTCAGGATTTTGTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087367481_1087367484 10 Left 1087367481 11:97239308-97239330 CCTCAGACAAAATCCTGAAACTG No data
Right 1087367484 11:97239341-97239363 CCTGTCTTTCACTGTACTTTAGG No data
1087367481_1087367485 15 Left 1087367481 11:97239308-97239330 CCTCAGACAAAATCCTGAAACTG No data
Right 1087367485 11:97239346-97239368 CTTTCACTGTACTTTAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087367481 Original CRISPR CAGTTTCAGGATTTTGTCTG AGG (reversed) Intergenic
No off target data available for this crispr