ID: 1087368967

View in Genome Browser
Species Human (GRCh38)
Location 11:97256964-97256986
Sequence ACACCAGTTCACTTTAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087368962_1087368967 15 Left 1087368962 11:97256926-97256948 CCTTATTTATGCTGCAAAACCAG No data
Right 1087368967 11:97256964-97256986 ACACCAGTTCACTTTAAAGTGGG No data
1087368965_1087368967 -4 Left 1087368965 11:97256945-97256967 CCAGTCTCAGGAAGAGGAGACAC No data
Right 1087368967 11:97256964-97256986 ACACCAGTTCACTTTAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087368967 Original CRISPR ACACCAGTTCACTTTAAAGT GGG Intergenic
No off target data available for this crispr