ID: 1087369311

View in Genome Browser
Species Human (GRCh38)
Location 11:97261629-97261651
Sequence CAGAGGTGCCCGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087369311_1087369315 7 Left 1087369311 11:97261629-97261651 CCATCTTCCCTCGGGCACCTCTG No data
Right 1087369315 11:97261659-97261681 TCAATTAAACACCACTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087369311 Original CRISPR CAGAGGTGCCCGAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr