ID: 1087371033

View in Genome Browser
Species Human (GRCh38)
Location 11:97284119-97284141
Sequence CCTCAGAAACTGGATGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087371028_1087371033 -6 Left 1087371028 11:97284102-97284124 CCCTTCAGGATAAAAACCCTCAG No data
Right 1087371033 11:97284119-97284141 CCTCAGAAACTGGATGTAGAAGG No data
1087371029_1087371033 -7 Left 1087371029 11:97284103-97284125 CCTTCAGGATAAAAACCCTCAGA No data
Right 1087371033 11:97284119-97284141 CCTCAGAAACTGGATGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087371033 Original CRISPR CCTCAGAAACTGGATGTAGA AGG Intergenic
No off target data available for this crispr