ID: 1087375174

View in Genome Browser
Species Human (GRCh38)
Location 11:97330649-97330671
Sequence ATACATATCAAAAAGCAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087375174_1087375176 16 Left 1087375174 11:97330649-97330671 CCTTTTTGCTTTTTGATATGTAT No data
Right 1087375176 11:97330688-97330710 TCAGCTTCCTGGTTTGTAAATGG No data
1087375174_1087375175 5 Left 1087375174 11:97330649-97330671 CCTTTTTGCTTTTTGATATGTAT No data
Right 1087375175 11:97330677-97330699 CTCTCTACATTTCAGCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087375174 Original CRISPR ATACATATCAAAAAGCAAAA AGG (reversed) Intergenic
No off target data available for this crispr