ID: 1087375175 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:97330677-97330699 |
| Sequence | CTCTCTACATTTCAGCTTCC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1087375173_1087375175 | 6 | Left | 1087375173 | 11:97330648-97330670 | CCCTTTTTGCTTTTTGATATGTA | No data | ||
| Right | 1087375175 | 11:97330677-97330699 | CTCTCTACATTTCAGCTTCCTGG | No data | ||||
| 1087375174_1087375175 | 5 | Left | 1087375174 | 11:97330649-97330671 | CCTTTTTGCTTTTTGATATGTAT | No data | ||
| Right | 1087375175 | 11:97330677-97330699 | CTCTCTACATTTCAGCTTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1087375175 | Original CRISPR | CTCTCTACATTTCAGCTTCC TGG | Intergenic | ||
| No off target data available for this crispr | |||||