ID: 1087375175

View in Genome Browser
Species Human (GRCh38)
Location 11:97330677-97330699
Sequence CTCTCTACATTTCAGCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087375173_1087375175 6 Left 1087375173 11:97330648-97330670 CCCTTTTTGCTTTTTGATATGTA No data
Right 1087375175 11:97330677-97330699 CTCTCTACATTTCAGCTTCCTGG No data
1087375174_1087375175 5 Left 1087375174 11:97330649-97330671 CCTTTTTGCTTTTTGATATGTAT No data
Right 1087375175 11:97330677-97330699 CTCTCTACATTTCAGCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087375175 Original CRISPR CTCTCTACATTTCAGCTTCC TGG Intergenic
No off target data available for this crispr