ID: 1087376128

View in Genome Browser
Species Human (GRCh38)
Location 11:97343005-97343027
Sequence CTGGTGAAGGGGTCCTCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087376128_1087376133 -5 Left 1087376128 11:97343005-97343027 CCAACTGAGGACCCCTTCACCAG No data
Right 1087376133 11:97343023-97343045 ACCAGCTTGTGTCATCTCTTGGG No data
1087376128_1087376135 2 Left 1087376128 11:97343005-97343027 CCAACTGAGGACCCCTTCACCAG No data
Right 1087376135 11:97343030-97343052 TGTGTCATCTCTTGGGAGAAAGG No data
1087376128_1087376136 3 Left 1087376128 11:97343005-97343027 CCAACTGAGGACCCCTTCACCAG No data
Right 1087376136 11:97343031-97343053 GTGTCATCTCTTGGGAGAAAGGG No data
1087376128_1087376132 -6 Left 1087376128 11:97343005-97343027 CCAACTGAGGACCCCTTCACCAG No data
Right 1087376132 11:97343022-97343044 CACCAGCTTGTGTCATCTCTTGG No data
1087376128_1087376137 4 Left 1087376128 11:97343005-97343027 CCAACTGAGGACCCCTTCACCAG No data
Right 1087376137 11:97343032-97343054 TGTCATCTCTTGGGAGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087376128 Original CRISPR CTGGTGAAGGGGTCCTCAGT TGG (reversed) Intergenic
No off target data available for this crispr