ID: 1087380630

View in Genome Browser
Species Human (GRCh38)
Location 11:97400385-97400407
Sequence CCTTTGAAGCAGATGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087380630_1087380637 11 Left 1087380630 11:97400385-97400407 CCTTCCACCATCTGCTTCAAAGG No data
Right 1087380637 11:97400419-97400441 GAGACTTATGGTTTGAGATTTGG No data
1087380630_1087380639 27 Left 1087380630 11:97400385-97400407 CCTTCCACCATCTGCTTCAAAGG No data
Right 1087380639 11:97400435-97400457 GATTTGGAAACTACCCAATTGGG No data
1087380630_1087380635 -1 Left 1087380630 11:97400385-97400407 CCTTCCACCATCTGCTTCAAAGG No data
Right 1087380635 11:97400407-97400429 GGACATCCAATAGAGACTTATGG No data
1087380630_1087380638 26 Left 1087380630 11:97400385-97400407 CCTTCCACCATCTGCTTCAAAGG No data
Right 1087380638 11:97400434-97400456 AGATTTGGAAACTACCCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087380630 Original CRISPR CCTTTGAAGCAGATGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr