ID: 1087383714

View in Genome Browser
Species Human (GRCh38)
Location 11:97442272-97442294
Sequence TATTTGTTCTGAAAAGTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087383714_1087383716 3 Left 1087383714 11:97442272-97442294 CCTGATACTTTTCAGAACAAATA No data
Right 1087383716 11:97442298-97442320 TTATAGTGTCCTTGATATGGTGG No data
1087383714_1087383715 0 Left 1087383714 11:97442272-97442294 CCTGATACTTTTCAGAACAAATA No data
Right 1087383715 11:97442295-97442317 AAGTTATAGTGTCCTTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087383714 Original CRISPR TATTTGTTCTGAAAAGTATC AGG (reversed) Intergenic
No off target data available for this crispr