ID: 1087389283

View in Genome Browser
Species Human (GRCh38)
Location 11:97513778-97513800
Sequence AACTTAGGGAGATTTTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087389283_1087389294 30 Left 1087389283 11:97513778-97513800 CCATCCAAAAATCTCCCTAAGTT No data
Right 1087389294 11:97513831-97513853 TGGATTGTACCTCAGTACTGAGG No data
1087389283_1087389292 10 Left 1087389283 11:97513778-97513800 CCATCCAAAAATCTCCCTAAGTT No data
Right 1087389292 11:97513811-97513833 TATACTTTTCCACATGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087389283 Original CRISPR AACTTAGGGAGATTTTTGGA TGG (reversed) Intergenic