ID: 1087389283 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:97513778-97513800 |
Sequence | AACTTAGGGAGATTTTTGGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1087389283_1087389294 | 30 | Left | 1087389283 | 11:97513778-97513800 | CCATCCAAAAATCTCCCTAAGTT | No data | ||
Right | 1087389294 | 11:97513831-97513853 | TGGATTGTACCTCAGTACTGAGG | No data | ||||
1087389283_1087389292 | 10 | Left | 1087389283 | 11:97513778-97513800 | CCATCCAAAAATCTCCCTAAGTT | No data | ||
Right | 1087389292 | 11:97513811-97513833 | TATACTTTTCCACATGTGTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1087389283 | Original CRISPR | AACTTAGGGAGATTTTTGGA TGG (reversed) | Intergenic | ||