ID: 1087389285

View in Genome Browser
Species Human (GRCh38)
Location 11:97513782-97513804
Sequence CCCAAACTTAGGGAGATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087389285_1087389292 6 Left 1087389285 11:97513782-97513804 CCAAAAATCTCCCTAAGTTTGGG No data
Right 1087389292 11:97513811-97513833 TATACTTTTCCACATGTGTTTGG No data
1087389285_1087389294 26 Left 1087389285 11:97513782-97513804 CCAAAAATCTCCCTAAGTTTGGG No data
Right 1087389294 11:97513831-97513853 TGGATTGTACCTCAGTACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087389285 Original CRISPR CCCAAACTTAGGGAGATTTT TGG (reversed) Intergenic