ID: 1087389290

View in Genome Browser
Species Human (GRCh38)
Location 11:97513793-97513815
Sequence GTATATGGTCCCCCAAACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087389290_1087389295 23 Left 1087389290 11:97513793-97513815 CCTAAGTTTGGGGGACCATATAC No data
Right 1087389295 11:97513839-97513861 ACCTCAGTACTGAGGATTGTAGG No data
1087389290_1087389294 15 Left 1087389290 11:97513793-97513815 CCTAAGTTTGGGGGACCATATAC No data
Right 1087389294 11:97513831-97513853 TGGATTGTACCTCAGTACTGAGG No data
1087389290_1087389292 -5 Left 1087389290 11:97513793-97513815 CCTAAGTTTGGGGGACCATATAC No data
Right 1087389292 11:97513811-97513833 TATACTTTTCCACATGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087389290 Original CRISPR GTATATGGTCCCCCAAACTT AGG (reversed) Intergenic
No off target data available for this crispr