ID: 1087389291 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:97513808-97513830 |
| Sequence | AACACATGTGGAAAAGTATA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1087389291_1087389294 | 0 | Left | 1087389291 | 11:97513808-97513830 | CCATATACTTTTCCACATGTGTT | No data | ||
| Right | 1087389294 | 11:97513831-97513853 | TGGATTGTACCTCAGTACTGAGG | No data | ||||
| 1087389291_1087389295 | 8 | Left | 1087389291 | 11:97513808-97513830 | CCATATACTTTTCCACATGTGTT | No data | ||
| Right | 1087389295 | 11:97513839-97513861 | ACCTCAGTACTGAGGATTGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1087389291 | Original CRISPR | AACACATGTGGAAAAGTATA TGG (reversed) | Intergenic | ||