ID: 1087389291

View in Genome Browser
Species Human (GRCh38)
Location 11:97513808-97513830
Sequence AACACATGTGGAAAAGTATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087389291_1087389294 0 Left 1087389291 11:97513808-97513830 CCATATACTTTTCCACATGTGTT No data
Right 1087389294 11:97513831-97513853 TGGATTGTACCTCAGTACTGAGG No data
1087389291_1087389295 8 Left 1087389291 11:97513808-97513830 CCATATACTTTTCCACATGTGTT No data
Right 1087389295 11:97513839-97513861 ACCTCAGTACTGAGGATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087389291 Original CRISPR AACACATGTGGAAAAGTATA TGG (reversed) Intergenic