ID: 1087389292

View in Genome Browser
Species Human (GRCh38)
Location 11:97513811-97513833
Sequence TATACTTTTCCACATGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087389290_1087389292 -5 Left 1087389290 11:97513793-97513815 CCTAAGTTTGGGGGACCATATAC No data
Right 1087389292 11:97513811-97513833 TATACTTTTCCACATGTGTTTGG No data
1087389283_1087389292 10 Left 1087389283 11:97513778-97513800 CCATCCAAAAATCTCCCTAAGTT No data
Right 1087389292 11:97513811-97513833 TATACTTTTCCACATGTGTTTGG No data
1087389285_1087389292 6 Left 1087389285 11:97513782-97513804 CCAAAAATCTCCCTAAGTTTGGG No data
Right 1087389292 11:97513811-97513833 TATACTTTTCCACATGTGTTTGG No data
1087389289_1087389292 -4 Left 1087389289 11:97513792-97513814 CCCTAAGTTTGGGGGACCATATA No data
Right 1087389292 11:97513811-97513833 TATACTTTTCCACATGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087389292 Original CRISPR TATACTTTTCCACATGTGTT TGG Intergenic