ID: 1087389293

View in Genome Browser
Species Human (GRCh38)
Location 11:97513820-97513842
Sequence AGGTACAATCCAAACACATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087389293_1087389295 -4 Left 1087389293 11:97513820-97513842 CCACATGTGTTTGGATTGTACCT No data
Right 1087389295 11:97513839-97513861 ACCTCAGTACTGAGGATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087389293 Original CRISPR AGGTACAATCCAAACACATG TGG (reversed) Intergenic