ID: 1087389294

View in Genome Browser
Species Human (GRCh38)
Location 11:97513831-97513853
Sequence TGGATTGTACCTCAGTACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087389289_1087389294 16 Left 1087389289 11:97513792-97513814 CCCTAAGTTTGGGGGACCATATA No data
Right 1087389294 11:97513831-97513853 TGGATTGTACCTCAGTACTGAGG No data
1087389290_1087389294 15 Left 1087389290 11:97513793-97513815 CCTAAGTTTGGGGGACCATATAC No data
Right 1087389294 11:97513831-97513853 TGGATTGTACCTCAGTACTGAGG No data
1087389285_1087389294 26 Left 1087389285 11:97513782-97513804 CCAAAAATCTCCCTAAGTTTGGG No data
Right 1087389294 11:97513831-97513853 TGGATTGTACCTCAGTACTGAGG No data
1087389291_1087389294 0 Left 1087389291 11:97513808-97513830 CCATATACTTTTCCACATGTGTT No data
Right 1087389294 11:97513831-97513853 TGGATTGTACCTCAGTACTGAGG No data
1087389283_1087389294 30 Left 1087389283 11:97513778-97513800 CCATCCAAAAATCTCCCTAAGTT No data
Right 1087389294 11:97513831-97513853 TGGATTGTACCTCAGTACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087389294 Original CRISPR TGGATTGTACCTCAGTACTG AGG Intergenic