ID: 1087389295

View in Genome Browser
Species Human (GRCh38)
Location 11:97513839-97513861
Sequence ACCTCAGTACTGAGGATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087389290_1087389295 23 Left 1087389290 11:97513793-97513815 CCTAAGTTTGGGGGACCATATAC No data
Right 1087389295 11:97513839-97513861 ACCTCAGTACTGAGGATTGTAGG No data
1087389291_1087389295 8 Left 1087389291 11:97513808-97513830 CCATATACTTTTCCACATGTGTT No data
Right 1087389295 11:97513839-97513861 ACCTCAGTACTGAGGATTGTAGG No data
1087389289_1087389295 24 Left 1087389289 11:97513792-97513814 CCCTAAGTTTGGGGGACCATATA No data
Right 1087389295 11:97513839-97513861 ACCTCAGTACTGAGGATTGTAGG No data
1087389293_1087389295 -4 Left 1087389293 11:97513820-97513842 CCACATGTGTTTGGATTGTACCT No data
Right 1087389295 11:97513839-97513861 ACCTCAGTACTGAGGATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087389295 Original CRISPR ACCTCAGTACTGAGGATTGT AGG Intergenic