ID: 1087398220

View in Genome Browser
Species Human (GRCh38)
Location 11:97630660-97630682
Sequence CCTAGCAAGGTAAAGTTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087398220_1087398224 25 Left 1087398220 11:97630660-97630682 CCAGCTAACTTTACCTTGCTAGG No data
Right 1087398224 11:97630708-97630730 CTACTTTCTGTCCCCTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087398220 Original CRISPR CCTAGCAAGGTAAAGTTAGC TGG (reversed) Intergenic
No off target data available for this crispr