ID: 1087401350

View in Genome Browser
Species Human (GRCh38)
Location 11:97670348-97670370
Sequence CTGTGTGTGTGCATGTATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087401350_1087401352 0 Left 1087401350 11:97670348-97670370 CCTACATACATGCACACACACAG No data
Right 1087401352 11:97670371-97670393 TCCCAGGTAATCACTGATCTAGG No data
1087401350_1087401356 28 Left 1087401350 11:97670348-97670370 CCTACATACATGCACACACACAG No data
Right 1087401356 11:97670399-97670421 TCAACAGAGGTTAATAAAAATGG No data
1087401350_1087401355 15 Left 1087401350 11:97670348-97670370 CCTACATACATGCACACACACAG No data
Right 1087401355 11:97670386-97670408 GATCTAGGTTCTGTCAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087401350 Original CRISPR CTGTGTGTGTGCATGTATGT AGG (reversed) Intergenic
No off target data available for this crispr