ID: 1087417019

View in Genome Browser
Species Human (GRCh38)
Location 11:97870301-97870323
Sequence CACTTTTACTAAAGGACAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087417019_1087417022 24 Left 1087417019 11:97870301-97870323 CCTATTGTCCTTTAGTAAAAGTG No data
Right 1087417022 11:97870348-97870370 TCTCTTGTCTTTTATTTTTTCGG No data
1087417019_1087417021 -9 Left 1087417019 11:97870301-97870323 CCTATTGTCCTTTAGTAAAAGTG No data
Right 1087417021 11:97870315-97870337 GTAAAAGTGATTTTCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087417019 Original CRISPR CACTTTTACTAAAGGACAAT AGG (reversed) Intergenic
No off target data available for this crispr