ID: 1087430948

View in Genome Browser
Species Human (GRCh38)
Location 11:98054379-98054401
Sequence GCAGGTAAGCATACAGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087430948_1087430953 24 Left 1087430948 11:98054379-98054401 CCTGCAACTGTATGCTTACCTGC No data
Right 1087430953 11:98054426-98054448 TGTACTAACGTAGATCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087430948 Original CRISPR GCAGGTAAGCATACAGTTGC AGG (reversed) Intergenic
No off target data available for this crispr