ID: 1087435068

View in Genome Browser
Species Human (GRCh38)
Location 11:98105920-98105942
Sequence TGCCATCTTGCATGTTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087435068_1087435071 22 Left 1087435068 11:98105920-98105942 CCACCAAAACATGCAAGATGGCA No data
Right 1087435071 11:98105965-98105987 AGAAGTCTTTGGAAATTTTCAGG No data
1087435068_1087435070 11 Left 1087435068 11:98105920-98105942 CCACCAAAACATGCAAGATGGCA No data
Right 1087435070 11:98105954-98105976 GTTAAAATATTAGAAGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087435068 Original CRISPR TGCCATCTTGCATGTTTTGG TGG (reversed) Intergenic
No off target data available for this crispr