ID: 1087436774

View in Genome Browser
Species Human (GRCh38)
Location 11:98129682-98129704
Sequence ATTTGTAATAGCAATGTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087436772_1087436774 -6 Left 1087436772 11:98129665-98129687 CCACCTAGTTTATGGTAATTTGT 0: 5
1: 78
2: 690
3: 2442
4: 5296
Right 1087436774 11:98129682-98129704 ATTTGTAATAGCAATGTAAATGG No data
1087436773_1087436774 -9 Left 1087436773 11:98129668-98129690 CCTAGTTTATGGTAATTTGTAAT No data
Right 1087436774 11:98129682-98129704 ATTTGTAATAGCAATGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087436774 Original CRISPR ATTTGTAATAGCAATGTAAA TGG Intergenic
No off target data available for this crispr