ID: 1087438097 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:98148423-98148445 |
| Sequence | TTGTGGTATGTGCCCCATAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 371 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 16, 4: 352} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1087438097_1087438100 | -4 | Left | 1087438097 | 11:98148423-98148445 | CCTTTATGGGGCACATACCACAA | 0: 1 1: 0 2: 2 3: 16 4: 352 |
||
| Right | 1087438100 | 11:98148442-98148464 | ACAAATGGAACTTGCGAGACTGG | No data | ||||
| 1087438097_1087438102 | 27 | Left | 1087438097 | 11:98148423-98148445 | CCTTTATGGGGCACATACCACAA | 0: 1 1: 0 2: 2 3: 16 4: 352 |
||
| Right | 1087438102 | 11:98148473-98148495 | CTGAGTGATCAATGAGTGAGTGG | No data | ||||
| 1087438097_1087438101 | -3 | Left | 1087438097 | 11:98148423-98148445 | CCTTTATGGGGCACATACCACAA | 0: 1 1: 0 2: 2 3: 16 4: 352 |
||
| Right | 1087438101 | 11:98148443-98148465 | CAAATGGAACTTGCGAGACTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1087438097 | Original CRISPR | TTGTGGTATGTGCCCCATAA AGG (reversed) | Intergenic | ||