ID: 1087438101

View in Genome Browser
Species Human (GRCh38)
Location 11:98148443-98148465
Sequence CAAATGGAACTTGCGAGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087438097_1087438101 -3 Left 1087438097 11:98148423-98148445 CCTTTATGGGGCACATACCACAA No data
Right 1087438101 11:98148443-98148465 CAAATGGAACTTGCGAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087438101 Original CRISPR CAAATGGAACTTGCGAGACT GGG Intergenic