ID: 1087438102

View in Genome Browser
Species Human (GRCh38)
Location 11:98148473-98148495
Sequence CTGAGTGATCAATGAGTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087438097_1087438102 27 Left 1087438097 11:98148423-98148445 CCTTTATGGGGCACATACCACAA No data
Right 1087438102 11:98148473-98148495 CTGAGTGATCAATGAGTGAGTGG No data
1087438099_1087438102 10 Left 1087438099 11:98148440-98148462 CCACAAATGGAACTTGCGAGACT No data
Right 1087438102 11:98148473-98148495 CTGAGTGATCAATGAGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087438102 Original CRISPR CTGAGTGATCAATGAGTGAG TGG Intergenic