ID: 1087438103 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:98148488-98148510 |
| Sequence | GTGAGTGGTGCATGATGTGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1087438099_1087438103 | 25 | Left | 1087438099 | 11:98148440-98148462 | CCACAAATGGAACTTGCGAGACT | No data | ||
| Right | 1087438103 | 11:98148488-98148510 | GTGAGTGGTGCATGATGTGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1087438103 | Original CRISPR | GTGAGTGGTGCATGATGTGA AGG | Intergenic | ||