ID: 1087448674

View in Genome Browser
Species Human (GRCh38)
Location 11:98288970-98288992
Sequence GTCATAGCCCTGTTAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087448670_1087448674 5 Left 1087448670 11:98288942-98288964 CCACAACACATGTGCACAGGCTT No data
Right 1087448674 11:98288970-98288992 GTCATAGCCCTGTTAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087448674 Original CRISPR GTCATAGCCCTGTTAATGGC AGG Intergenic
No off target data available for this crispr