ID: 1087464380

View in Genome Browser
Species Human (GRCh38)
Location 11:98486430-98486452
Sequence ACCATGGATGTCAGCGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087464380_1087464385 -1 Left 1087464380 11:98486430-98486452 CCACAGACGCTGACATCCATGGT No data
Right 1087464385 11:98486452-98486474 TGGGTATTGGTTCAAATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087464380 Original CRISPR ACCATGGATGTCAGCGTCTG TGG (reversed) Intergenic
No off target data available for this crispr